WormBase Tree Display for Variation: WBVar00317467
expand all nodes | collapse all nodes | view schema
WBVar00317467 | Name | Public_name | tm5221 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C30C11 | ||||
Flanking_sequences | ttaaataaagttaattaatacacgaatttc | ataacaataaaattcaagaaataagtcaac | ||||||
Mapping_target | C30C11 | |||||||
Source_location | 7 | CHROMOSOME_III | 8443679 | 8443872 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5221_external | |||||||
tm5221_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5221 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "...compared to WT animals, all Ufm1 cascade mutants displayed a significantly higher rate of pharynx grinder paralysis in the presence of aldicarb (Figure 3A), pointing to a pathophysiological mechanism involving an increased amount of ACh in the neuromuscular junctions." ACh = acetylcholine | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Treatment | Animals treated with 0.5 mM aldicarb for 60 minutes | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000303 | Paper_evidence | WBPaper00050013 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In a next step, using a computer-aided chemotaxis assay, we analyzed the effects of the Ufm1 cascade on C. elegans sensorial behavior by a chemotaxis assay with the attractant diacetyl. Results revealed a decreased ability in sensing diacetyl in all mutants compared to WT animals (Figure 3C), pointing to a failure in the C. elegans sensory system in the absence of the Ufm1 cascade and its targets." | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002819 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002634 | Paper_evidence | WBPaper00050013 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In addition, because C. elegans uba-5(ok3364) mutants are resistant to ER stress, we monitored the effect of dithiothreitol (DDT) treatment on all Ufm1 cascade mutants and found that, compared to WT, they were resistant to ER stress (Figure 3B)." | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004908 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Treatment | 18 hr treatment with the ER-stressor dithiothreitol (DTT, 11 mM), | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00050013 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Wild-type (N2 Bristol) and Ufm1 cascade mutant worms (Table S3) did not show a seizure phenotype in the presence of PTZ, whereas PTZ-sensitive worms (unc-43) showed severe seizure phenotypes (data not shown)." PTZ = pentylenetetrazole | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Treatment | Animals were treated with pentylenetetrazole | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00050013 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Treatment with levamisole, an ACh receptor agonist known to paralyze worms, did not induce differences in motility between control and mutant worms (Figure S5), suggesting that the alteration of Ufm1 cascade and of Ufbp1 and Cdkr3 induce increased ACh release in neuromuscular junctions." | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00050013 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Treatment | Animals treated with 0.4 mM levamisole for 3 hours | Paper_evidence | WBPaper00050013 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Disease_info | Models_disease | DOID:0050709 | ||||||
Models_disease_in_annotation | WBDOannot00000814 | |||||||
Reference | WBPaper00050013 | |||||||
Remark | [C30C11] 1196/1197-[C30C11] 1388/1389 (192 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |