WormBase Tree Display for Variation: WBVar00296476
expand all nodes | collapse all nodes | view schema
WBVar00296476 | Evidence | Paper_evidence | WBPaper00036467 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy5353 | |||||||
HGVSg | chrI:g.12643049G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | cb25.fpc4122 | |||||
Flanking_sequences | aaaaggagaaggatggagtatcgaagaatg | tgagattcaagacctatttttggggaaaaa | |||||||
Mapping_target | cb25.fpc4122 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00036467 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis briggsae | |||||||
Strain | WBStrain00048094 | ||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00038147 | |||||||
Transcript | CBG18802.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | CBG18802.1:c.1093+1G>A | ||||||||
Intron_number | 7/10 | ||||||||
Interactor | WBInteraction000504429 | ||||||||
WBInteraction000504430 | |||||||||
WBInteraction000518852 | |||||||||
WBInteraction000518874 | |||||||||
WBInteraction000518875 | |||||||||
Description | Phenotype | WBPhenotype:0000165 | Paper_evidence | WBPaper00036467 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Uninduced P7.p and P8.p in pry-1 mutants are frequently unfused. Also some cases of unfused P(9-11).p were observed in pry-1 mutants. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00036467 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a high frequency of ectopically induced VPCs. Specifically, mid-L4 stage animals showed a unique defect in VPC induction pattern; P3.p, P4.p, and P8.p were ectopically induced in most animals whereas P7.p remained uninduced. In some cases only P5.p and P6.p were induced. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00036467 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All induced VPCs (except P6.p) adopted secondary cell fates. Four secondary lineage markers, namely egl-17::GFP (ayIs4), lin-11::GFP (syIs80),ceh-2::GFP (syIs54) (all mid/late-L4 stage) and dhs-31::GFP (syIs101)(old adult stage), were expressed in the progeny of all induced VPCs,P6.p excepted. The expression of primary lineage markers, egl-17::GFP (ayIs4) (early/mid-L3 stage), daf-6::YFP(bhEx53) and syg-2::GFP (wyEx3372) (both mid/late-L4 stage) was localized to P6.p progeny. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000533 | Paper_evidence | WBPaper00041660 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some of the Pn.p appeared small and morphologically similar to P12.pa. | Paper_evidence | WBPaper00041660 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Paper_evidence | WBPaper00041660 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00036467 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lip-1 reporter expression in Cbr-pry-1(sy5353) animals revealed a similar profile to controls but the fluorescence was much higher in P7.p and P8.p cells. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001792 | Paper_evidence | WBPaper00036467 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All P(7-11).p cell nuclei were significantly smaller in size compared to wild type, appearing similar to P12.pa. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006776 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006777 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006778 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006779 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004410 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (2) | |||||||||
Method | Substitution_allele |