WormBase Tree Display for Variation: WBVar00278332
expand all nodes | collapse all nodes | view schema
WBVar00278332 | Evidence | Paper_evidence | WBPaper00059519 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | eg33 | |||||||
Other_name (14) | |||||||||
HGVSg | CHROMOSOME_I:g.11532000C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F32B4 | |||||
Flanking_sequences | GGAGATGACTAATCGATGCATGACAGCTAG | CAGACTATTGATTGAGGTTCCTGAAAAACA | |||||||
Mapping_target | F15D3 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00059519 | ||||
Curator_confirmed | WBPerson51134 | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004037 | ||||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001131 | |||||||
Transcript | F15D3.1j.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15D3.1j.1:c.6351G>A | ||||||||
HGVSp | CE49315:p.Trp2117Ter | ||||||||
cDNA_position | 8501 | ||||||||
CDS_position | 6351 | ||||||||
Protein_position | 2117 | ||||||||
Exon_number | 34/40 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F15D3.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15D3.1a.1:c.9861G>A | ||||||||
HGVSp | CE27129:p.Trp3287Ter | ||||||||
cDNA_position | 9920 | ||||||||
CDS_position | 9861 | ||||||||
Protein_position | 3287 | ||||||||
Exon_number | 42/49 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F15D3.1d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15D3.1d.1:c.6384G>A | ||||||||
HGVSp | CE49191:p.Trp2128Ter | ||||||||
cDNA_position | 6384 | ||||||||
CDS_position | 6384 | ||||||||
Protein_position | 2128 | ||||||||
Exon_number | 26/32 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F15D3.1i.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15D3.1i.1:c.9150G>A | ||||||||
HGVSp | CE49403:p.Trp3050Ter | ||||||||
cDNA_position | 9150 | ||||||||
CDS_position | 9150 | ||||||||
Protein_position | 3050 | ||||||||
Exon_number | 36/42 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F15D3.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15D3.1c.1:c.9183G>A | ||||||||
HGVSp | CE49296:p.Trp3061Ter | ||||||||
cDNA_position | 9183 | ||||||||
CDS_position | 9183 | ||||||||
Protein_position | 3061 | ||||||||
Exon_number | 37/43 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F15D3.1h.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15D3.1h.1:c.9828G>A | ||||||||
HGVSp | CE24903:p.Trp3276Ter | ||||||||
cDNA_position | 9828 | ||||||||
CDS_position | 9828 | ||||||||
Protein_position | 3276 | ||||||||
Exon_number | 40/47 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F15D3.1e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F15D3.1e.1:c.3570G>A | ||||||||
HGVSp | CE49456:p.Trp1190Ter | ||||||||
cDNA_position | 3570 | ||||||||
CDS_position | 3570 | ||||||||
Protein_position | 1190 | ||||||||
Exon_number | 14/20 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000504222 | ||||||||
WBInteraction000504536 | |||||||||
WBInteraction000541771 | |||||||||
Genetics | Interpolated_map_position | I | 9.1062 | ||||||
Description | Phenotype | WBPhenotype:0000027 | Paper_evidence | WBPaper00064747 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Decreased endogenous sulfur levels (Figure 1) | Paper_evidence | WBPaper00064747 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
EQ_annotations | Molecule_affected | WBMol:00002928 | PATO:0001997 | Paper_evidence | WBPaper00064747 | ||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0000548 | Paper_evidence | WBPaper00046657 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | dys-1 mutants forced to burrow in pipettes showed extensive muscle cell degeneration, therefore burrowing hastens muscular degeneration in these worms. | Paper_evidence | WBPaper00046657 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Genotype | Pmyo-3::GFP (Pmyo-3::GFP) | Paper_evidence | WBPaper00046657 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000980 | Paper_evidence | WBPaper00061159 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Figure 5A | Paper_evidence | WBPaper00061159 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00065125 | |||||||
Curator_confirmed | WBPerson937 | ||||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00065125 | |||||||
Curator_confirmed | WBPerson937 | ||||||||
WBPhenotype:0001575 | Paper_evidence | WBPaper00064747 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Figure 5 | Paper_evidence | WBPaper00064747 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0002294 | Paper_evidence | WBPaper00035538 | |||||||
Curator_confirmed | WBPerson2876 | ||||||||
WBPhenotype:0002559 | Paper_evidence | WBPaper00046657 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | When burrowing bends were faster, more variable in amplitude, and dampened posteriorly compared with wild-type burrowing. | Paper_evidence | WBPaper00046657 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002617 | Paper_evidence | WBPaper00064747 | |||||||
WBPaper00065125 | |||||||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPerson937 | |||||||||
Remark | Figure 7 | Paper_evidence | WBPaper00064747 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0002659 | Paper_evidence | WBPaper00061159 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Figure 5D | Paper_evidence | WBPaper00061159 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0001265 | Paper_evidence | WBPaper00046657 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002320 | Paper_evidence | WBPaper00046657 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0004025 | Paper_evidence | WBPaper00046657 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Disease_info | Models_disease | DOID:11723 | |||||||
Models_disease_in_annotation | WBDOannot00000422 | ||||||||
WBDOannot00000423 | |||||||||
WBDOannot00001434 | |||||||||
WBDOannot00001438 | |||||||||
Reference | WBPaper00035538 | ||||||||
WBPaper00046657 | |||||||||
WBPaper00061159 | |||||||||
WBPaper00059519 | |||||||||
WBPaper00044415 | |||||||||
WBPaper00064747 | |||||||||
WBPaper00065125 | |||||||||
Method | Substitution_allele |