WormBase Tree Display for Variation: WBVar00278323
expand all nodes | collapse all nodes | view schema
WBVar00278323 | Evidence | Paper_evidence | WBPaper00004490 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | q113 | ||||||
Other_name | Y113G7B.5b.1:c.655G>A | |||||||
CE39287:p.Gly219Arg | ||||||||
Y113G7B.5a.1:c.655G>A | ||||||||
CE23287:p.Gly219Arg | ||||||||
HGVSg | CHROMOSOME_V:g.20200126G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y113G7B | ||||
Flanking_sequences | tggaaacgcgctaaatcgattaatattgag | gacgtgtatgcgaagatattcccattgagc | ||||||
Mapping_target | Y113G7B | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004490 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | JK | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001482 | ||||||
Transcript | Y113G7B.5b.1 (12) | |||||||
Y113G7B.5a.1 (12) | ||||||||
Genetics | Interpolated_map_position | V | 24.9218 | |||||
Description | Phenotype | WBPhenotype:0001683 | Paper_evidence | WBPaper00001037 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | There is no evidence of sperm, spermatogenesis, or germ cell death in fog-2 XX mutants. Further, oogenesis begins in fog-2 mutants at about the time spermatogenesis begins in wild type. fog-2 X0 males are unaffected | Paper_evidence | WBPaper00001037 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00001037 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00001037 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00001037 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (2) | ||||||||
Method | Substitution_allele |