WormBase Tree Display for Variation: WBVar00278318
expand all nodes | collapse all nodes | view schema
WBVar00278318 | Evidence | Paper_evidence | WBPaper00004490 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | q154 | |||||
Other_name | Y113G7B.5b.1:c.3G>A | ||||||
CE23287:p.Met1? | |||||||
CE39287:p.Met1? | |||||||
Y113G7B.5a.1:c.3G>A | |||||||
HGVSg | CHROMOSOME_V:g.20199296G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | Y113G7B | |||
Flanking_sequences | cgccggatttcaaccaatcgaaacgaaaat | agtgaaaatttgacggatgagttggatttg | |||||
Mapping_target | Y113G7B | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004490 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | JK | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001482 | |||||
Transcript (2) | |||||||
Genetics | Interpolated_map_position | V | 24.9178 | ||||
Description | Phenotype | WBPhenotype:0001683 | Paper_evidence | WBPaper00001037 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | There is no evidence of sperm, spermatogenesis, or germ cell death in fog-2 XX mutants. Further, oogenesis begins in fog-2 mutants at about the time spermatogenesis begins in wild type. fog-2 X0 males are unaffected | Paper_evidence | WBPaper00001037 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00001037 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001037 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00001037 | ||||||
WBPaper00004490 | |||||||
Method | Substitution_allele |