WormBase Tree Display for Variation: WBVar00278196
expand all nodes | collapse all nodes | view schema
WBVar00278196 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2364 | |||
Other_name | ZC21.2b.1:c.984+49C>T | ||||
ZC21.2a.1:c.972+49C>T | |||||
HGVSg | CHROMOSOME_III:g.8537837C>T | ||||
Sequence_details | SMap | S_parent | Sequence | ZC21 | |
Flanking_sequences | AATTGTGCAACAAATAATTTATTATTTCAG | TCAACTAAATTCCCTGAACACATATTATTA | |||
Mapping_target | ZC21 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037339 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006614 | |||
Transcript | ZC21.2a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | ZC21.2a.1:c.972+49C>T | ||||
Intron_number | 6/16 | ||||
ZC21.2b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZC21.2b.1:c.984+49C>T | ||||
Intron_number | 6/15 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |