WormBase Tree Display for Variation: WBVar00277929

WBVar00277929 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5328
    Other_name: Y56A3A.1a.1:c.1015+131G>A
    HGVSg: CHROMOSOME_III:g.11842985C>T
  Sequence_details: SMap: S_parent: Sequence: Y56A3A
    Flanking_sequences: AATCGGTAACTTGCCGGATTTGAAAATTTC GGCGAATCGGCACTTTTTAACCATTTTTCC
    Mapping_target: Y56A3A
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00003826
    Transcript: Y56A3A.1a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y56A3A.1a.1:c.1015+131G>A
        Intron_number: 4/9
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele