WormBase Tree Display for Variation: WBVar00277850
expand all nodes | collapse all nodes | view schema
| WBVar00277850 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | ok5836 | |||
| Other_name | CE20276:p.Ser539= | ||||
| Y51A2A.5.1:c.1617C>T | |||||
| HGVSg | CHROMOSOME_V:g.18300422C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | Y51A2A | |
| Flanking_sequences | TCCTCCGTTTGACTTGGTTCCTCAGACAAG | TGTGAATTGGAAAGTGTACTGGAATCGGAT | |||
| Mapping_target | Y51A2A | ||||
| Type_of_mutation | Substitution | C | T | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033306 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00013061 | |||
| Transcript | Y51A2A.5.1 | VEP_consequence | synonymous_variant | ||
| VEP_impact | LOW | ||||
| HGVSc | Y51A2A.5.1:c.1617C>T | ||||
| HGVSp | CE20276:p.Ser539= | ||||
| cDNA_position | 1617 | ||||
| CDS_position | 1617 | ||||
| Protein_position | 539 | ||||
| Exon_number | 1/1 | ||||
| Codon_change | agC/agT | ||||
| Amino_acid_change | S | ||||
| Isolation | Mutagen | EMS | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
