WormBase Tree Display for Variation: WBVar00277688

WBVar00277688 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2153
    Other_name: CE38117:p.Thr8=
      Y39A1A.9.1:c.24T>C
    HGVSg: CHROMOSOME_III:g.10633476A>G
  Sequence_details: SMap: S_parent: Sequence: Y39A1A
    Flanking_sequences: GGCAAAGTCGTTCGGGAACGTCGTCTTGAT GTTGGGTCCATTGTTCGAGCCATTTCTGTA
    Mapping_target: Y39A1A
    Type_of_mutation: Substitution: A G
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037286
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00012648
    Transcript: Y39A1A.9.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: Y39A1A.9.1:c.24T>C
        HGVSp: CE38117:p.Thr8=
        cDNA_position: 26
        CDS_position: 24
        Protein_position: 8
        Exon_number: 2/6
        Codon_change: acT/acC
        Amino_acid_change: T
  Isolation: Mutagen: UV/TMP
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele