WormBase Tree Display for Variation: WBVar00277624

WBVar00277624 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2358
  Sequence_details: SMap: S_parent: Sequence: Y32H12A
    Flanking_sequences: attcgcctaaaataatgactctaaccattc cctaaaataatgactctaaccattcgccta
    Mapping_target: Y32H12A
    Type_of_mutation: Substitution: g a Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037339
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
    Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: KO_consortium_allele