WormBase Tree Display for Variation: WBVar00277547
expand all nodes | collapse all nodes | view schema
WBVar00277547 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1925 | |||
Other_name | Y116A8C.16e.1:c.1227G>A | ||||
Y116A8C.16b.1:c.267+3985G>A | |||||
Y116A8C.16a.1:c.2172G>A | |||||
Y116A8C.16f.1:c.381G>A | |||||
CE43461:p.Met724Ile | |||||
CE50625:p.Met409Ile | |||||
CE46762:p.Met726Ile | |||||
CE50657:p.Met127Ile | |||||
Y116A8C.16c.1:c.2178G>A | |||||
HGVSg | CHROMOSOME_IV:g.17009105G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y116A8C | |
Flanking_sequences | CCGGCTTGGAGCGGTCTACTCGCCTTGTAT | CGTCGGGAATTCGGCCTATGGGAGGCTATC | |||
Mapping_target | Y116A8C | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00004403 | |||
Transcript | Y116A8C.16a.1 (12) | ||||
Y116A8C.16b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | Y116A8C.16b.1:c.267+3985G>A | ||||
Intron_number | 1/1 | ||||
Y116A8C.16c.1 (12) | |||||
Y116A8C.16f.1 (12) | |||||
Y116A8C.16e.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |