WormBase Tree Display for Variation: WBVar00277419
expand all nodes | collapse all nodes | view schema
| WBVar00277419 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | gk1980 | |||
| Other_name | CE31083:p.Gly142Glu | ||||
| W02F12.5.1:c.425G>A | |||||
| HGVSg | CHROMOSOME_V:g.6708513C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | W02F12 | |
| Flanking_sequences | CTGTACAAAAATTAACTCACAGACGAGCCT | CGCCTGCTCCTGGCTGAAGTTTATAAAGCT | |||
| Mapping_target | W02F12 | ||||
| Type_of_mutation | Substitution | C | T | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00036970 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00020950 | |||
| Transcript | W02F12.5.1 (12) | ||||
| Isolation | Mutagen | EMS | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Allele confirmed by Sanger sequencing | |||||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
