WormBase Tree Display for Variation: WBVar00277374
expand all nodes | collapse all nodes | view schema
WBVar00277374 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2653 | |||
Other_name | T28B11.10:n.30G>A | ||||
T28B11.1a.2:c.-49-5925C>T | |||||
HGVSg | CHROMOSOME_V:g.10721173G>A | ||||
Sequence_details | SMap | S_parent | Sequence | T28B11 | |
Flanking_sequences | GGTGGACGGGTTCGTAGCATATGAACAACG | TTCATTTCTCTTGTGTGGGTCACCAGAAAA | |||
Mapping_target | T28B11 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037340 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00196735 | |||
WBGene00012117 | |||||
Transcript | T28B11.10 | VEP_consequence | non_coding_transcript_exon_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | T28B11.10:n.30G>A | ||||
cDNA_position | 30 | ||||
Exon_number | 1/1 | ||||
T28B11.1a.2 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T28B11.1a.2:c.-49-5925C>T | ||||
Intron_number | 1/6 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |