WormBase Tree Display for Variation: WBVar00277244

WBVar00277244 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5752
    Other_name: T10H9.4.1:c.*405G>A
    HGVSg: CHROMOSOME_V:g.6655604C>T
  Sequence_details: SMap: S_parent: Sequence: T10H9
    Flanking_sequences: CCATTTTATTCGCATCTAATGGGTAAATTT CGGGGGGAATGAGAAGGCATGTTGTTAGTC
    Mapping_target: T10H9
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004897
    Transcript: T10H9.4.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: T10H9.4.1:c.*405G>A
        cDNA_position: 765
        Exon_number: 4/4
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele