WormBase Tree Display for Variation: WBVar00277177
expand all nodes | collapse all nodes | view schema
| WBVar00277177 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | ok5303 | |||
| Other_name | CE31585:p.Met152Val | ||||
| T04A6.1.1:c.454A>G | |||||
| HGVSg | CHROMOSOME_III:g.7617474A>G | ||||
| Sequence_details | SMap | S_parent | Sequence | T04A6 | |
| Flanking_sequences | ATCAATTTTTCAGTGGACATGCTGAAATTT | TGCTGCTTCGCAAAATCTGTCGTCATGATC | |||
| Mapping_target | T04A6 | ||||
| Type_of_mutation | Substitution | A | G | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033305 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00020200 | |||
| Transcript | T04A6.1.1 (12) | ||||
| Isolation | Mutagen | ENU | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
