WormBase Tree Display for Variation: WBVar00277143
expand all nodes | collapse all nodes | view schema
WBVar00277143 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2356 | |||
Other_name | CE43575:p.Thr228Asn | ||||
R74.4b.1:c.683C>A | |||||
R74.4a.1:c.632C>A | |||||
CE01057:p.Thr211Asn | |||||
HGVSg | CHROMOSOME_III:g.4192591C>A | ||||
Sequence_details | SMap | S_parent | Sequence | R74 | |
Flanking_sequences | AAGAAAGTGGGAAACGAGGAAAAGCCGGAA | TCAAGCCGACATGTTCTTTGTACCGTACAA | |||
Mapping_target | R74 | ||||
Type_of_mutation | Substitution | C | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037339 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00001034 | |||
Transcript | R74.4a.1 (12) | ||||
R74.4b.1 (12) | |||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |