WormBase Tree Display for Variation: WBVar00277136
expand all nodes | collapse all nodes | view schema
WBVar00277136 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5806 | |||
Other_name | R186.5c.1:c.45-2320C>T | ||||
R186.5b.1:c.53+1896C>T | |||||
R186.5a.2:c.-11+1896C>T | |||||
R186.5a.1:c.-10-2320C>T | |||||
HGVSg | CHROMOSOME_V:g.12978661G>A | ||||
Sequence_details | SMap | S_parent | Sequence | R186 | |
Flanking_sequences | TATCGTTTCAGGCTATTTTGATTATAATCA | TTATTCCTAATGTAAGAAAATACTCCGTTT | |||
Mapping_target | R186 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00004793 | |||
Transcript | R186.5c.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | R186.5c.1:c.45-2320C>T | ||||
Intron_number | 1/9 | ||||
R186.5b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | R186.5b.1:c.53+1896C>T | ||||
Intron_number | 1/9 | ||||
R186.5a.2 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | R186.5a.2:c.-11+1896C>T | ||||
Intron_number | 1/11 | ||||
R186.5a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | R186.5a.1:c.-10-2320C>T | ||||
Intron_number | 1/11 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |