WormBase Tree Display for Variation: WBVar00277088

WBVar00277088 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2326
    Other_name: R07G3.1.1:c.486+95T>A
    HGVSg: CHROMOSOME_II:g.7617140T>A
  Sequence_details: SMap: S_parent: Sequence: R07G3
    Flanking_sequences: TAAAATAAAATATCATCCAATCCACGAAACCTAATCAAATAATAAATTTT AAATATTAAAACGAGGCTCTTGTGGAAATACGTGACACTTTAAAATATAA
    Mapping_target: R07G3
    Type_of_mutation: Substitution: T A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037339
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000390
    Transcript: R07G3.1.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: R07G3.1.1:c.486+95T>A
        Intron_number: 4/5
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele