WormBase Tree Display for Variation: WBVar00277054

WBVar00277054 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5472
    Other_name: R04D3.8.1:c.522G>A
      CE51446:p.Glu174=
    HGVSg: CHROMOSOME_X:g.13299588C>T
  Sequence_details: SMap: S_parent: Sequence: R04D3
    Flanking_sequences: CTGAAGTTTCATTAGACCAACGATGGAATA TCCGTGGCGTTTGCATTTTTGAGTGCTAGT
    Mapping_target: R04D3
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00005117
    Transcript: R04D3.8.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: R04D3.8.1:c.522G>A
        HGVSp: CE51446:p.Glu174=
        cDNA_position: 602
        CDS_position: 522
        Protein_position: 174
        Exon_number: 3/7
        Codon_change: gaG/gaA
        Amino_acid_change: E
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele