WormBase Tree Display for Variation: WBVar00276938

WBVar00276938 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2694
    Other_name: K09E2.4a.1:c.-17+143G>A
    HGVSg: CHROMOSOME_X:g.8660810G>A
  Sequence_details: SMap: S_parent: Sequence: K09E2
    Flanking_sequences: TGGCAGGTGTGTAAGAAGAAATGGATATGG AAAGAAACGAGAAATTGATCGTGATTATCG
    Mapping_target: K09E2
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037340
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004369
    Transcript: K09E2.4a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: K09E2.4a.1:c.-17+143G>A
        Intron_number: 1/19
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele