WormBase Tree Display for Variation: WBVar00276876

WBVar00276876 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5789
    Other_name: K03B8.4.1:c.14C>T
      CE06078:p.Ser5Leu
    HGVSg: CHROMOSOME_V:g.11395111G>A
  Sequence_details: SMap: S_parent: Sequence: K03B8
    Flanking_sequences: CCGCTCAGCTCGTTCATAGTCTTCAGGTCC AATTCTGGCTCATCACCCAGCTTTTGATGA
    Mapping_target: K03B8
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00010523
    Transcript: K03B8.4.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: K03B8.4.1:c.14C>T
        HGVSp: CE06078:p.Ser5Leu
        cDNA_position: 14
        CDS_position: 14
        Protein_position: 5
        Exon_number: 1/2
        Codon_change: tCg/tTg
        Amino_acid_change: S/L
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele