WormBase Tree Display for Variation: WBVar00276553

WBVar00276553 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk1905
    Other_name: F42A9.1b.1:c.3064-690G>A
      F42A9.1a.1:c.3217-690G>A
    HGVSg: CHROMOSOME_IV:g.8641095G>A
  Sequence_details: SMap: S_parent: Sequence: F42A9
    Flanking_sequences: ATTGGAACATTTATTTTGAATGAAATAGAA CACACATATGGGACAATTCTGGATTTCTAG
    Mapping_target: F42A9
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00006483
    Transcript: F42A9.1a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F42A9.1a.1:c.3217-690G>A
        Intron_number: 16/20
      F42A9.1b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F42A9.1b.1:c.3064-690G>A
        Intron_number: 15/19
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele