WormBase Tree Display for Variation: WBVar00276547
expand all nodes | collapse all nodes | view schema
WBVar00276547 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2473 | |||
Other_name | F41E7.7b.1:c.50+1234C>T | ||||
F41E7.6.1:c.825+4G>A | |||||
HGVSg | CHROMOSOME_X:g.10309156C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F41E7 | |
Flanking_sequences | AACAGTGTAAAATTGTACTCCTGACCCTAA | TACCTCAGATTCATTTTCCACAAAATCATC | |||
Mapping_target | F41E7 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037339 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00009623 | |||
WBGene00009622 | |||||
Transcript | F41E7.6.1 | VEP_consequence | splice_region_variant,intron_variant | ||
VEP_impact | LOW | ||||
HGVSc | F41E7.6.1:c.825+4G>A | ||||
Intron_number | 6/15 | ||||
F41E7.7b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | F41E7.7b.1:c.50+1234C>T | ||||
Intron_number | 2/5 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |