WormBase Tree Display for Variation: WBVar00276466
expand all nodes | collapse all nodes | view schema
WBVar00276466 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5002 | |||
Other_name | F32B5.7a.2:c.1801G>A | ||||
CE50006:p.Gly529Ser | |||||
F32B5.7a.1:c.1801G>A | |||||
F32B5.7b.1:c.1585G>A | |||||
CE30526:p.Gly601Ser | |||||
HGVSg | CHROMOSOME_I:g.2674829C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F32B5 | |
Flanking_sequences | ACCATTTTCCTTTTATGATCGCGTAGTCGC | TTCCTTGTTAAGGATCACAAAAGCTCGTTC | |||
Mapping_target | F32B5 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033304 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00017980 | |||
Transcript | F32B5.7a.1 (12) | ||||
F32B5.7a.2 (12) | |||||
F32B5.7b.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |