WormBase Tree Display for Variation: WBVar00276321
expand all nodes | collapse all nodes | view schema
WBVar00276321 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5466 | |||
Other_name | F13D2.1b.1:c.789T>C | ||||
CE47830:p.His263= | |||||
CE47903:p.His263= | |||||
F13D2.1a.1:c.789T>C | |||||
HGVSg | CHROMOSOME_X:g.11187670A>G | ||||
Sequence_details | SMap | S_parent | Sequence | F13D2 | |
Flanking_sequences | ACTAACTTCTCCAGACCGCAGATGAGTCAG | TGACTTCGGTCCTGTGATGAAGATCCAACT | |||
Mapping_target | F13D2 | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00008735 | |||
Transcript | F13D2.1b.1 | VEP_consequence | synonymous_variant | ||
VEP_impact | LOW | ||||
HGVSc | F13D2.1b.1:c.789T>C | ||||
HGVSp | CE47830:p.His263= | ||||
cDNA_position | 840 | ||||
CDS_position | 789 | ||||
Protein_position | 263 | ||||
Exon_number | 9/39 | ||||
Codon_change | caT/caC | ||||
Amino_acid_change | H | ||||
F13D2.1a.1 | VEP_consequence | synonymous_variant | |||
VEP_impact | LOW | ||||
HGVSc | F13D2.1a.1:c.789T>C | ||||
HGVSp | CE47903:p.His263= | ||||
cDNA_position | 789 | ||||
CDS_position | 789 | ||||
Protein_position | 263 | ||||
Exon_number | 8/38 | ||||
Codon_change | caT/caC | ||||
Amino_acid_change | H | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |