WormBase Tree Display for Variation: WBVar00276195

WBVar00276195 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk1381
    Other_name: CE36992:p.Arg256=
      D1069.3b.2:c.768T>A
      D1069.3b.1:c.768T>A
    HGVSg: CHROMOSOME_II:g.345074A>T
  Sequence_details: SMap: S_parent: Sequence: D1069
    Flanking_sequences: ATGATTCAAAAACTCTCCGGACACTTGCTG CGTGGTTTTTTTGAAAAATCTTCGATAATC
    Mapping_target: D1069
    Type_of_mutation: Substitution: A T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036969
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00017037
    Transcript: D1069.3b.2 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: D1069.3b.2:c.768T>A
        HGVSp: CE36992:p.Arg256=
        cDNA_position: 855
        CDS_position: 768
        Protein_position: 256
        Exon_number: 7/13
        Codon_change: cgT/cgA
        Amino_acid_change: R
      D1069.3b.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: D1069.3b.1:c.768T>A
        HGVSp: CE36992:p.Arg256=
        cDNA_position: 885
        CDS_position: 768
        Protein_position: 256
        Exon_number: 7/12
        Codon_change: cgT/cgA
        Amino_acid_change: R
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele