WormBase Tree Display for Variation: WBVar00275923
expand all nodes | collapse all nodes | view schema
WBVar00275923 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5205 | |||
Other_name | CE29680:p.Phe241= | ||||
C27A12.8.1:c.723C>T | |||||
HGVSg | CHROMOSOME_I:g.6059741G>A | ||||
Sequence_details | SMap | S_parent | Sequence | C27A12 | |
Flanking_sequences | TTCATGCCAATCGTGACCACAAGAGAAGCA | AATCGAGATCCACAGGAGCATACGACGAGG | |||
Mapping_target | C27A12 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00305288 | |||
WBGene00016158 | |||||
Transcript | C27A12.14 | ||||
C27A12.8.1 | VEP_consequence | synonymous_variant | |||
VEP_impact | LOW | ||||
HGVSc | C27A12.8.1:c.723C>T | ||||
HGVSp | CE29680:p.Phe241= | ||||
cDNA_position | 724 | ||||
CDS_position | 723 | ||||
Protein_position | 241 | ||||
Exon_number | 6/9 | ||||
Codon_change | ttC/ttT | ||||
Amino_acid_change | F | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |