WormBase Tree Display for Variation: WBVar00275820

WBVar00275820 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2768
    Other_name: CE08092:p.Ser327Tyr
      C10H11.3.1:c.980C>A
    HGVSg: CHROMOSOME_I:g.4734613C>A
  Sequence_details: SMap: S_parent: Sequence: C10H11
    Flanking_sequences: ACAGAAATGGACTGCTGGAGGCCATCAAAT CGAGCCAAATGTCACATTTATTTGGAAATA
    Mapping_target: C10H11
    Type_of_mutation: Substitution: C A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005866
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00015692
    Transcript: C10H11.3.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: C10H11.3.1:c.980C>A
        HGVSp: CE08092:p.Ser327Tyr
        cDNA_position: 997
        CDS_position: 980
        Protein_position: 327
        Exon_number: 6/7
        Codon_change: tCc/tAc
        Amino_acid_change: S/Y
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele