WormBase Tree Display for Variation: WBVar00275724
expand all nodes | collapse all nodes | view schema
| WBVar00275724 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | gk2989 | |||
| Other_name | C04F2.2:n.504-62T>A | ||||
| HGVSg | CHROMOSOME_V:g.7500251A>T | ||||
| Sequence_details | SMap | S_parent | Sequence | C04F2 | |
| Flanking_sequences | TTTTTTTTTGTTTTTGAAAATAGTTTTGAA | GTCGGGGGTAGTCCGGAAATGATTACGGCA | |||
| Mapping_target | C04F2 | ||||
| Type_of_mutation | Substitution | A | T | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00005866 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00005431 | |||
| Pseudogene | C04F2.2 | VEP_consequence | intron_variant,non_coding_transcript_variant | ||
| VEP_impact | MODIFIER | ||||
| HGVSc | C04F2.2:n.504-62T>A | ||||
| Intron_number | 2/3 | ||||
| Isolation | Mutagen | EMS | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
