WormBase Tree Display for Variation: WBVar00275404
expand all nodes | collapse all nodes | view schema
WBVar00275404 | Evidence | Paper_evidence | WBPaper00035074 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ye494 | ||||||
Other_name | CE36501:p.Ser261Leu | |||||||
T07A5.2.1:c.782C>T | ||||||||
HGVSg | CHROMOSOME_III:g.10315013G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T07A5 | ||||
Flanking_sequences | cacaaaactcaatacttcctctatcccatct | gttcattttcatgttctttgtggcgacactg | ||||||
Mapping_target | T07A5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035074 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | HY | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006785 | ||||||
Transcript | T07A5.2.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | T07A5.2.1:c.782C>T | |||||||
HGVSp | CE36501:p.Ser261Leu | |||||||
cDNA_position | 814 | |||||||
CDS_position | 782 | |||||||
Protein_position | 261 | |||||||
Exon_number | 5/6 | |||||||
Codon_change | tCg/tTg | |||||||
Amino_acid_change | S/L | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | 2.30734 | |||||
Description | Phenotype | WBPhenotype:0000421 | Paper_evidence | WBPaper00035074 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | trb mutants are qualitatively and quantitatively resistant to levamisole | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00035074 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001578 | Paper_evidence | WBPaper00035074 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | trb mutants are qualitatively and quantitatively resistant to pyrantel (L-subtype nAChR agonist) | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001852 | Paper_evidence | WBPaper00035074 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | All trb mutants are clearly resistant to tribendimidine-induced mortality and tribendimidine-induced sterility | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00035074 | |||||||
Method | Substitution_allele |