WormBase Tree Display for Variation: WBVar00275227
expand all nodes | collapse all nodes | view schema
WBVar00275227 | Name | Public_name | x37 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y110A7A.3.1:c.446+1G>A | |||||||
HGVSg | CHROMOSOME_I:g.5143964G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y110A7A | ||||
Flanking_sequences | tgaatgggcaccgcctgcgatctataaaag | tgaaaacttaaaagaaggattgaaacaaga | ||||||
Mapping_target | Y110A7A | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040927 | |||||||
Laboratory | ZZ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006797 | ||||||
Transcript | Y110A7A.3.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y110A7A.3.1:c.446+1G>A | |||||||
Intron_number | 5/11 | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00024530 | ||||
Genetics | Interpolated_map_position | I | -0.354557 | |||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 2mM aldicarb | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000421 | Paper_evidence | WBPaper00000484 | ||||||
WBPaper00027611 | ||||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00000484 | ||||
WBPaper00027611 | ||||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Phenotype_assay | Treatment | 1mM levamisole | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00027611 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001315 | Paper_evidence | WBPaper00029130 | ||||||
Curator_confirmed | WBPerson14391 | |||||||
Remark | No levamisole-AChR activity observed in isolated muscle cells | Paper_evidence | WBPaper00029130 | |||||
Curator_confirmed | WBPerson14391 | |||||||
WBPhenotype:0001578 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Animals are resistant to the cholinergic agonist carbachol. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 1mM carbachol | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00034750 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants show defects in swimming | Paper_evidence | WBPaper00034750 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0001853 | Paper_evidence | WBPaper00035150 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant response to AAD 1470 was comparable to that observed in wild-type | Paper_evidence | WBPaper00035150 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Disease_info | Models_disease | DOID:3635 | ||||||
Models_disease_in_annotation | WBDOannot00000871 | |||||||
WBDOannot00000872 | ||||||||
Reference | WBPaper00027611 | |||||||
WBPaper00025762 | ||||||||
WBPaper00029130 | ||||||||
WBPaper00035150 | ||||||||
WBPaper00016014 | ||||||||
WBPaper00000484 | ||||||||
WBPaper00016188 | ||||||||
WBPaper00018321 | ||||||||
WBPaper00023610 | ||||||||
WBPaper00034750 | ||||||||
Method | Substitution_allele |