WormBase Tree Display for Variation: WBVar00275215
expand all nodes | collapse all nodes | view schema
WBVar00275215 | Name | Public_name | x20 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F21F3.5.1:c.199-1G>A | |||||||
HGVSg | CHROMOSOME_I:g.4900477C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F21F3 | ||||
Flanking_sequences | taatctttatctaatcttgaaccaatttca | cacgagattgatcagattatgacgtgttcg | ||||||
Mapping_target | F21F3 | |||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson22169 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00006774 | ||||||
Transcript | F21F3.5.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F21F3.5.1:c.199-1G>A | |||||||
Intron_number | 3/9 | |||||||
Interactor | WBInteraction000502320 | |||||||
Isolation | Reverse_genetics | PCR | ||||||
Genetics | Interpolated_map_position | I | -0.649245 | |||||
Mapping_data | In_2_point | 243 | ||||||
244 | ||||||||
524 | ||||||||
In_multi_point (13) | ||||||||
Description | Phenotype | WBPhenotype:0000421 | Paper_evidence | WBPaper00034730 | ||||
WBPaper00035548 | ||||||||
WBPaper00027611 | ||||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Remark | unc-38 mutants are resistant to levamisole | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00034730 | ||||
WBPaper00027611 | ||||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
WBPhenotype:0000562 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 1mM levamisole | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000484 | ||||||
WBPaper00035548 | ||||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Remark | No backward motion in L1 larvae. Newly hatched larvae can barely move forward. Adults have a mild Unc defect where the mutants move forward in a slow decayed sine wave. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
EQ_annotations | Life_stage (2) | |||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | In unc-38(x20) mutants, steady-state currents were significantly smaller than in wild type, suggesting altered nAChR desensitization | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001203 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | unc-38 mutants are resistant to nicotine | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | ACh and levamisole-evoked PSCs were significantly reduced in mutants | Paper_evidence | WBPaper00034730 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants tend to remain within the borders of bacterial lawns as does the wild-type. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00027611 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Attraction to sodium chloride is normal (See methods). | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00027611 | |||||||
WBPaper00035548 | ||||||||
WBPaper00034730 | ||||||||
WBPaper00000484 | ||||||||
WBPaper00016088 | ||||||||
Remark | cag to caa Splice-site Point Mutation. | Person_evidence | WBPerson22169 | |||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006774 Acceptor | ||||||||
Method | Substitution_allele |