WormBase Tree Display for Variation: WBVar00275213
expand all nodes | collapse all nodes | view schema
| WBVar00275213 | Name | Public_name | x18 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | Y110A7A.3.1:c.110-1G>A | ||||||
| HGVSg | CHROMOSOME_I:g.5142174G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y110A7A | |||
| Flanking_sequences | tcgccaaaaagaaaaactaaaaatatttca | attacaataaactggtgcgaccggtcagtg | |||||
| Mapping_target | Y110A7A | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00040032 | ||||||
| WBStrain00040929 | |||||||
| Laboratory | ZZ | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006797 | |||||
| Transcript | Y110A7A.3.1 | VEP_consequence | splice_acceptor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y110A7A.3.1:c.110-1G>A | ||||||
| Intron_number | 2/11 | ||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00024268 | |||
| Genetics | Interpolated_map_position | I | -0.357566 | ||||
| Mapping_data | In_2_point | 245 | |||||
| 246 | |||||||
| In_multi_point (4) | |||||||
| Description | Phenotype (5) | ||||||
| Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000484 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Recessive | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000478 | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutants tend to remain within the borders of bacterial lawns as does the wild-type. | Paper_evidence | WBPaper00000484 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Recessive | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001084 | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Attraction to sodium chloride is normal (See methods). | Paper_evidence | WBPaper00000484 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Recessive | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001414 | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Recessive | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00000484 | ||||||
| WBPaper00018321 | |||||||
| Method | Substitution_allele |
