WormBase Tree Display for Variation: WBVar00275068
expand all nodes | collapse all nodes | view schema
| WBVar00275068 | Name (3) | ||||||
|---|---|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | C09E10 | |||
| Flanking_sequences | tgaagtccaatttttgcatattgtgttttg | taaatagtcgagattggaatttttccggat | |||||
| Mapping_target | C09E10 | ||||||
| Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | LX | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000958 | |||||
| Transcript | C09E10.2d.1 (12) | ||||||
| C09E10.2c.1 (12) | |||||||
| C09E10.2a.1 (12) | |||||||
| C09E10.2e.1 (12) | |||||||
| C09E10.2b.1 (12) | |||||||
| Genetics | Interpolated_map_position | X | -18.8717 | ||||
| Remark | This allele contains two substitution mutations. In addition to the N(745) aac to atc mutation there is also a silent mutation at 750 of gca to gcg which has flanking sequences of atctcgactatttaacaaaacacaatatgc and aaaattggacttcagaaaatgttcttcgaa. | Paper_evidence | WBPaper00024616 | ||||
| Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
