WormBase Tree Display for Variation: WBVar00274922
expand all nodes | collapse all nodes | view schema
WBVar00274922 | Evidence | Paper_evidence | WBPaper00035146 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ur304 | |||||
Other_name (2) | |||||||
HGVSg | CHROMOSOME_I:g.5682728G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T19B4 | |||
Flanking_sequences | gctattctatcaggaaaagatcgtcacaatg | acgtgggcatggatcagcggcttctggcgat | |||||
Mapping_target | T19B4 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035146 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (23) | |||||||
Laboratory | IM | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006776 | |||||
Transcript | T19B4.7.1 (12) | ||||||
Interactor (14) | |||||||
Genetics | Interpolated_map_position | I | 0.308076 | ||||
Description | Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00035146 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The unc-40(ur304) mutation does not alter the asymmetric localization of UNC-40 | Paper_evidence | WBPaper00035146 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The unc-40(ur304) mutation does not cause cell or axon migration defects | Paper_evidence | WBPaper00035146 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The unc-40(ur304) mutation does not cause cell or axon migration defects | Paper_evidence | WBPaper00035146 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | UNC-40::GFP is ventrally localized as in wild type animals. | Paper_evidence | WBPaper00035146 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000886 | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The unc-40(ur304) mutation itself does not produce a visible phenotype. | Paper_evidence | WBPaper00035146 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00035146 | ||||||
Method | Substitution_allele |