WormBase Tree Display for Variation: WBVar00274918
expand all nodes | collapse all nodes | view schema
WBVar00274918 | Evidence | Paper_evidence | WBPaper00031828 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ur280 | |||||||
Other_name | CE47844:p.Lys369Asn | ||||||||
T25E12.10.1:c.1107T>C | |||||||||
HGVSg | CHROMOSOME_V:g.16733943A>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | T25E12 | |||||
Flanking_sequences | AATCGACTTCAAAAATCAATAGCCCGTTTGCATAAAAAGAACTCCTGAAC | TTACAGTTCATTGTATACCAATCGCCATCATAAGGACCTCCACGTGCAAC | |||||||
Mapping_target | T25E12 | ||||||||
Type_of_mutation | Substitution | t | g | Paper_evidence | WBPaper00031828 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | IM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00012025 | |||||||
Transcript | T25E12.10.1 (11) | ||||||||
Interactor (19) | |||||||||
Genetics | Interpolated_map_position | V | 11.1306 | ||||||
Description | Phenotype | WBPhenotype:0000961 | Paper_evidence | WBPaper00031828 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In 86% of clec-38 mutants, the distribution of SNB-1::GFP puncta is irregular, leaving clear areas in the dorsal and ventral cord. The number of dorsal and ventral cord puncta is reduced in clec-38 mutants. In addition, the remaining puncta are of irregular shape and size. | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UNC-40::GFP expression is increased. | Paper_evidence | WBPaper00035146 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00031828 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In 86% of clec-38 mutants, the distribution of SNB-1::GFP puncta is irregular, leaving clear areas in the dorsal and ventral cord. The number of dorsal and ventral cord puncta is reduced in clec-38 mutants. In addition, the remaining puncta are of irregular shape and size. | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000180 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Axons were not mispositioned. | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00035146 | |||||||
WBPaper00031828 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The HSN axon migration pattern is no different from that observed in wild type animals. | Paper_evidence | WBPaper00035146 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals do not exhibit dorsal or ventral guidance defects. | Paper_evidence | WBPaper00031828 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00035146 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UNC-40::GFP is ventrally localized as in wild type animals. | Paper_evidence | WBPaper00035146 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
UNC-40::GFP is more ventrally localized as in wild type animals. | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031828 | ||||||||
WBPaper00035146 | |||||||||
Method | Substitution_allele |