WormBase Tree Display for Variation: WBVar00266710
expand all nodes | collapse all nodes | view schema
WBVar00266710 | Evidence | Paper_evidence | WBPaper00004813 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ua2 | ||||||
HGVSg | CHROMOSOME_III:g.5227862_5228571del | |||||||
Sequence_details | SMap | S_parent | Sequence | C34E10 | ||||
Flanking_sequences | ttggcaatcgaggtggcgtagttgagaagc | tcagctcaaacaatgttgagtccaagaagg | ||||||
Mapping_target | C34E10 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00024104 | |||||||
WBStrain00024105 | ||||||||
Laboratory | LB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000229 | ||||||
WBGene00303005 | ||||||||
WBGene00016411 | ||||||||
Transcript | C34E10.12a.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-20 | |||||||
CDS_position | ?-20 | |||||||
Protein_position | ?-7 | |||||||
Exon_number | 1/1 | |||||||
C34E10.6.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-108 | |||||||
CDS_position | ?-97 | |||||||
Protein_position | ?-33 | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 1-3/8 | |||||||
C34E10.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-108 | |||||||
CDS_position | ?-97 | |||||||
Protein_position | ?-33 | |||||||
Intron_number | 2/6 | |||||||
Exon_number | 1-3/7 | |||||||
C34E10.10.1 | VEP_consequence | 5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-23 | |||||||
Exon_number | 1/5 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | III | -1.93862 | |||||
Mapping_data | In_multi_point | 4167 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00024944 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000083 | Paper_evidence | WBPaper00024944 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00058699 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | We found that isp-1 and atp-2 strains had decreased worm length when exposed to low concentrations of sodium arsenite. In the 8-day old worms, the nuo-6, mev-1, and atp-2 strains were more sensitive to sodium arsenite compared to the N2 strain. Synchronized worms were exposed to 500 M sodium arsenite beginning 2 days post hatch for 48 hours. Immediately after the exposure, steady state ATP levels were measured using the Promega CellTiterGlo Luminescent assay and normalized to protein per worm (adapted from Bailey et al. 2016). Although we report no significant differences, there is a strong trend of decreased ATP in the nuo-6 and atp-2 mutant strains | Paper_evidence | WBPaper00058699 | |||||
Curator_confirmed | WBPerson712 | |||||||
Image | WBPicture0000014932 | Paper_evidence | WBPaper00058699 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001860 | Paper_evidence | WBPaper00058699 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00024944 | |||||||
WBPaper00005808 | ||||||||
WBPaper00058699 | ||||||||
Remark | Corrected flanks based on U10402.1 genbank sequence. | |||||||
Method | Deletion_allele |