WormBase Tree Display for Variation: WBVar00266529
expand all nodes | collapse all nodes | view schema
WBVar00266529 | Evidence | Paper_evidence | WBPaper00035070 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | u75 | |||||||
Other_name | T01E8.4.1:c.352C>T | ||||||||
CE02308:p.Gln118Ter | |||||||||
HGVSg | CHROMOSOME_II:g.10239289G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01E8 | |||||
Flanking_sequences | agtgtgatgcttttcgagaataataataag | aattctgtctatctggatccagagatcgaac | |||||||
Mapping_target | T01E8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035070 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035032 | ||||||||
Laboratory | TU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003177 | |||||||
Transcript | T01E8.4.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T01E8.4.1:c.352C>T | ||||||||
HGVSp | CE02308:p.Gln118Ter | ||||||||
cDNA_position | 359 | ||||||||
CDS_position | 352 | ||||||||
Protein_position | 118 | ||||||||
Exon_number | 3/8 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000517351 | ||||||||
WBInteraction000517355 | |||||||||
WBInteraction000517361 | |||||||||
WBInteraction000578996 | |||||||||
Genetics | Interpolated_map_position | II | 2.31522 | ||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00035070 | |||||
WBPaper00001125 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | This mutation confers partial touch insensitivity. some animals respond to many touches while others fail to respond after a few touches. The severity of the phenotype increases at higher temperatures. | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
25 | Paper_evidence | WBPaper00001125 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00002482 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00002482 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00035070 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited distorted cell-body morphology; somas were generally larger and misshapen as well as accumulated more jsIs821[RAB-3::GFP] reporter product. This phenotype is stronger at higher temperatures. | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005237 | PATO:0000460 | Paper_evidence | WBPaper00035070 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000944 | Paper_evidence | WBPaper00059745 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | Shortening ALM and PLM neurites | Paper_evidence | WBPaper00059745 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00059745 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00059745 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
GO_term | GO:0043005 | PATO:0002364 | Paper_evidence | WBPaper00059745 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001933 | Paper_evidence | WBPaper00035070 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The pattern of jsIs821[RAB-3::GFP] localization was disrupted; often reduced or abolished. This phenotype is stronger at higher temperatures. Localization of non-synaptic components appear to be normal. The distribution of a non-synaptic component, mechanosensory channel subunit, appears to be normal. Levels of MEC-18, that is diffusely expressed in the cytoplasm were unchanged in these mutants compared to control animals. The density of TRN microtubules were also unaffected compared to control animals. | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035070 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001125 | ||||||||
WBPaper00035070 | |||||||||
WBPaper00002482 | |||||||||
WBPaper00045955 | |||||||||
WBPaper00059745 | |||||||||
Method | Substitution_allele |