WormBase Tree Display for Variation: WBVar00266519
expand all nodes | collapse all nodes | view schema
WBVar00266519 | Evidence | Paper_evidence | WBPaper00003969 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | u56 | |||||
Other_name | T01C8.7.1:c.1801C>T | ||||||
CE39109:p.Arg601Cys | |||||||
HGVSg | CHROMOSOME_X:g.16804186G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T01C8 | |||
Flanking_sequences | gtgctgaaagagtgcagatgtggagatcca | gtttcccagtccctgaaaatgcacggcatt | |||||
Mapping_target | T01C8 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003969 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TU | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003168 | |||||
Transcript | T01C8.7.1 (12) | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00003969 | |||
Genetics | Interpolated_map_position | X | 24.0626 | ||||
Reference | WBPaper00003969 | ||||||
Remark | This allele comprises two separate substitutions. In addition to that already described, u56 also contains a second c to t substitution within a different exon, resulting in a A713D mutation. | Paper_evidence | WBPaper00003969 | ||||
Method | Substitution_allele |