WormBase Tree Display for Variation: WBVar00266484
expand all nodes | collapse all nodes | view schema
WBVar00266484 | Evidence | Paper_evidence | WBPaper00005563 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | tz2 | ||||||
Other_name (5) | ||||||||
HGVSg | CHROMOSOME_III:g.11692677_11693655del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y41C4A | ||||
Flanking_sequences | agcgaaagagtgccgcagaaaaaagaaggt | atttcctaatttttgaaagaaaaaaaattg | ||||||
Mapping_target | Y41C4A | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040751 | |||||||
WBStrain00047812 | ||||||||
Laboratory | YT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000793 | ||||||
Transcript | Y41C4A.4e.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y41C4A.4e.1:c.801+3_*101del | |||||||
cDNA_position | ?-1082 | |||||||
Intron_number | 7/8 | |||||||
Exon_number | 8-9/9 | |||||||
Y41C4A.4g.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y41C4A.4g.1:c.1167+3_*101del | |||||||
cDNA_position | ?-1388 | |||||||
Intron_number | 5/6 | |||||||
Exon_number | 6-7/7 | |||||||
Y41C4A.4b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 6/6 | |||||||
Exon_number | 7/7 | |||||||
Y41C4A.4a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y41C4A.4a.1:c.858+3_*101del | |||||||
cDNA_position | ?-1181 | |||||||
Intron_number | 7/8 | |||||||
Exon_number | 8-9/9 | |||||||
Y41C4A.4d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y41C4A.4d.1:c.876+3_*101del | |||||||
cDNA_position | ?-1197 | |||||||
Intron_number | 7/8 | |||||||
Exon_number | 8-9/9 | |||||||
Y41C4A.4f.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y41C4A.4f.1:c.450+3_*101del | |||||||
cDNA_position | ?-937 | |||||||
Intron_number | 4/5 | |||||||
Exon_number | 5-6/6 | |||||||
Y41C4A.4c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 6/6 | |||||||
Exon_number | 7/7 | |||||||
Interactor | WBInteraction000546931 | |||||||
Genetics | Interpolated_map_position | III | 11.7926 | |||||
Description | Phenotype | WBPhenotype:0000478 | Paper_evidence | WBPaper00039855 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 17 deg C-cultivated crh-1(tz2) mutants migrated to colder regions; this behavior is similar wild-type animals; however, 23 and 20 deg C-cultivated crh-1(tz2) animals migrated towards colder regions than wild-type animals. | Expression of CRH-1 in AFD restores the behavioural defect of crh-1(tz2) mutants. | Paper_evidence | WBPaper00039855 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000997 | Paper_evidence | WBPaper00039855 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 17 deg C-cultivated crh-1(tz2) mutants migrated to colder regions; this behavior is similar wild-type animals; however, 23 and 20 deg C-cultivated crh-1(tz2) animals migrated towards colder regions than wild-type animals. | Expression of CRH-1 in AFD restores the behavioural defect of crh-1(tz2) mutants. | Paper_evidence | WBPaper00039855 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000999 | Paper_evidence | WBPaper00039855 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 17 deg C-cultivated crh-1(tz2) mutants migrated to colder regions; this behavior is similar wild-type animals; however, 23 and 20 deg C-cultivated crh-1(tz2) animals migrated towards colder regions than wild-type animals. | Expression of CRH-1 in AFD restores the behavioural defect of crh-1(tz2) mutants. | Paper_evidence | WBPaper00039855 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | |||||||
Remark | Quoted from paper: "We found that fluorescence of the glr-1 transcriptional reporter was increased in crh-1(tz2) loss-of-function mutants (Fig 3F), consistent with a role for CREB as a downstream target of CMK-1 in regulating glr-1transcription." | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | |||||||
Phenotype_assay | Strain | WBStrain00047812 | Paper_evidence | WBPaper00049891 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Control_strain | WBStrain00047313 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | |||||||
Genotype | pzIs29 [Pglr-1::NLS-GFP::LacZ::unc-54 3'UTR] | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | |||||||
WBPhenotype:0001785 | Paper_evidence | WBPaper00046360 | ||||||
WBPaper00040253 | ||||||||
Curator_confirmed | WBPerson3142 | |||||||
WBPerson1251 | ||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00039855 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | AFD neurons exhibit attenuation of calcium-concentration changes when cultivated at 20 and 23 deg C; the magnitude of calcium-concentration changes of AFD neurons in crh-1(tz2) mutants is significantly lower than that in wild-type animals. | Paper_evidence | WBPaper00039855 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00039821 | ||||||
Curator_confirmed | WBPerson5364 | |||||||
Remark | Figure 2, crh-1(tz2) mutant worms fail to form long-term memory of habituation training. Figure 4, rescuing crh-1(+) in the MAGI-1, but not MEC-4, expressing neurons rescues the long-term memory defects of crh-1(tz2) mutant worms. | Paper_evidence | WBPaper00039821 | |||||
Curator_confirmed | WBPerson5364 | |||||||
WBPhenotype:0002567 | Paper_evidence | WBPaper00036296 | ||||||
Curator_confirmed | WBPerson3142 | |||||||
Remark | The cmk-1:crh-1β transgene rescues the long-term associative olfactory memory defect of crh-1(tz2) (Figure 3C) | Paper_evidence | WBPaper00036296 | |||||
Curator_confirmed | WBPerson3142 | |||||||
Rescued_by_transgene | WBTransgene00026445 | |||||||
WBPhenotype:0002568 | Paper_evidence | WBPaper00041586 | ||||||
Curator_confirmed | WBPerson10038 | |||||||
Remark | Table 1. Quoted from paper "crh-1 is required for long-term but not short-term memory for both associative and non-associative memory." | Paper_evidence | WBPaper00041586 | |||||
Curator_confirmed | WBPerson10038 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00041586 | ||||
Curator_confirmed | WBPerson10038 | |||||||
WBPhenotype:0002599 | Paper_evidence | WBPaper00041586 | ||||||
Curator_confirmed | WBPerson10038 | |||||||
Remark | Table 1. Quoted from paper "crh-1 is required for long-term but not short-term memory for both associative and non-associative memory." | Paper_evidence | WBPaper00041586 | |||||
Curator_confirmed | WBPerson10038 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00041586 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Phenotype_not_observed (2) | ||||||||
Reference | WBPaper00039821 | |||||||
WBPaper00039855 | ||||||||
WBPaper00040253 | ||||||||
WBPaper00010064 | ||||||||
WBPaper00005563 | ||||||||
WBPaper00036296 | ||||||||
WBPaper00046360 | ||||||||
WBPaper00049050 | ||||||||
WBPaper00041586 | ||||||||
WBPaper00049891 | ||||||||
Method | Deletion_allele |