WormBase Tree Display for Variation: WBVar00263693
expand all nodes | collapse all nodes | view schema
WBVar00263693 | Name | Public_name | ttTi39948 | ||
---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C25G4 | |
Flanking_sequences | CCATCGGAACCCATCGCTTTCACTTTAAAG | TATAGTTTGTGAAGTGGTGGGTATGAATCA | |||
Mapping_target | C25G4 | ||||
Type_of_mutation | Insertion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Transposon_insertion | Mos | ||||
Origin (7) | |||||
Affects | Gene | WBGene00007735 | |||
Transcript | C25G4.8.1 | ||||
Reference | WBPaper00040752 | ||||
WBPaper00028894 | |||||
WBPaper00033043 | |||||
Remark | [20060613 ls] the TA insertion site may be +/- 10bp from this location | ||||
[20060613 ls] the right side of Mos is facing the left of the sequence | |||||
[20060613 ls] this MOS insertion generated thanks to a grant of the European Union (project NEMAGENETAG) | |||||
For further information and strain requests please visit http://ums3421.univ-lyon1.fr/ | |||||
Method | NemaGENETAG_consortium_allele |