WormBase Tree Display for Variation: WBVar00252974

WBVar00252974 Name: Public_name: tm4578
    Other_name (13)
    HGVSg: CHROMOSOME_IV:g.4017123_4017561del
  Sequence_details: SMap: S_parent: Sequence: W02C12
    Flanking_sequences: agaattgttcctttgttgagtttcatgtct gatgtgttcttcggcaacatttgtccgagc
    Mapping_target: W02C12
    Source_location: 7 CHROMOSOME_IV 4017122 4017562 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4578_external
      tm4578_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4578
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020930
    Transcript (13)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 11759/11760-12198/12199 (439 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele