WormBase Tree Display for Variation: WBVar00252802

WBVar00252802 Name: Public_name: tm4292
    Other_name: Y38H6C.20.1:c.9_247-5del
    HGVSg: CHROMOSOME_V:g.20550703_20551156del
  Sequence_details: SMap: S_parent: Sequence: Y38H6C
    Flanking_sequences: cagtcgattgttagtgaggattcgttctgt aaaatcatgatttttcttcacatttggaag
    Mapping_target: Y38H6C
    Source_location: 7 CHROMOSOME_V 20550702 20551157 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4292_external
      tm4292_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4292
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012632
    Transcript: Y38H6C.20.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y38H6C.20.1:c.9_247-5del
        cDNA_position: 41-?
        CDS_position: 9-?
        Protein_position: 3-?
        Intron_number: 2/15
        Exon_number: 2/16
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 54777/54778-55231/55232 (454 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele