WormBase Tree Display for Variation: WBVar00252692

WBVar00252692 Name: Public_name: tm4166
    Other_name: CE28168:p.Arg169LysfsTer13
      ZC581.7.1:c.503_738del
    HGVSg: CHROMOSOME_I:g.6660982_6661328del
  Sequence_details: SMap: S_parent: Sequence: ZC581
    Flanking_sequences: gacgatttccttgtgaatgagacagtttcg cttccttcatcatctcggctaatgattctt
    Mapping_target: ZC581
    Source_location: 7 CHROMOSOME_I 6660981 6661329 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4166_external
      tm4166_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4166
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022634
    Transcript: ZC581.7.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 29410/29411-29757/29758 (347 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele