WormBase Tree Display for Variation: WBVar00252407

WBVar00252407 Name: Public_name: tm3800
    Other_name: F26E4.9.1:c.15_186+72del
      F26E4.9.2:c.15_186+72del
    HGVSg: CHROMOSOME_I:g.9789023_9789266del
  Sequence_details: SMap: S_parent: Sequence: F26E4
    Flanking_sequences: caattgtatttttcagatggctcaacttgc agctaattgtgagctacttcgctctcgaga
    Mapping_target: F26E4
    Source_location: 7 CHROMOSOME_I 9789022 9789267 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3800_external
      tm3800_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3800
    NBP_allele
    Status: Live
  Affects (2)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 34162/34163-34406/34407 (244 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele