WormBase Tree Display for Variation: WBVar00252015

WBVar00252015 Name: Public_name: tm3287
    Other_name: CE35990:p.Ala175IlefsTer9
      K06A1.1.1:c.522_765del
    HGVSg: CHROMOSOME_II:g.6455588_6456054del
  Sequence_details: SMap: S_parent: Sequence: K06A1
    Flanking_sequences: aagctctacaactaaatatcgggttactgt cattcccgagaaattggaatctacttgaca
    Mapping_target: K06A1
    Source_location: 7 CHROMOSOME_II 6455587 6456055 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3287_external
      tm3287_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008309
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3287
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019424
    Transcript: K06A1.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description (2)
  Reference: WBPaper00057148
  Remark: 14256/14257-14723/14724 (467 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele