WormBase Tree Display for Variation: WBVar00251698
expand all nodes | collapse all nodes | view schema
WBVar00251698 | Name | Public_name | tm2877 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C43H6.9b.1:c.1881_2244-26delinsAAGGAAGCGCATCAGAGAG | |||||||
C43H6.9a.2:c.1239_1602-26delinsAAGGAAGCGCATCAGAGAG | ||||||||
C43H6.9a.1:c.1239_1602-26delinsAAGGAAGCGCATCAGAGAG | ||||||||
HGVSg | CHROMOSOME_X:g.2414996_2415478delinsCTCTCTGATGCGCTTCCTT | |||||||
Sequence_details | SMap | S_parent | Sequence | C43H6 | ||||
Flanking_sequences | aaattctgcaagactccttgttttttgaat | tacgtctctgatgcgcttcctttaattggt | ||||||
Mapping_target | C43H6 | |||||||
Source_location | 7 | CHROMOSOME_X | 2414995 | 2415479 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CTCTCTGATGCGCTTCCTT | ||||||
Deletion | ||||||||
PCR_product | tm2877_external | |||||||
tm2877_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2877 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001618 | ||||||
Transcript | C43H6.9a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C43H6.9a.1:c.1239_1602-26delinsAAGGAAGCGCATCAGAGAG | |||||||
cDNA_position | 1332-? | |||||||
CDS_position | 1239-? | |||||||
Protein_position | 413-? | |||||||
Intron_number | 9-11/13 | |||||||
Exon_number | 9-11/14 | |||||||
C43H6.9a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C43H6.9a.2:c.1239_1602-26delinsAAGGAAGCGCATCAGAGAG | |||||||
cDNA_position | 1478-? | |||||||
CDS_position | 1239-? | |||||||
Protein_position | 413-? | |||||||
Intron_number | 12-14/16 | |||||||
Exon_number | 12-14/17 | |||||||
C43H6.9b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C43H6.9b.1:c.1881_2244-26delinsAAGGAAGCGCATCAGAGAG | |||||||
cDNA_position | 1881-? | |||||||
CDS_position | 1881-? | |||||||
Protein_position | 627-? | |||||||
Intron_number | 12-14/15 | |||||||
Exon_number | 12-14/16 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000478 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. I. Mori: normal thermotaxis at 20C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | IK | |||||||
WBPhenotype:0001182 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Ashrafi: wild-type Nile Red staining. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KQ | |||||||
Remark | 19770/19771-CTCTCTGATGCGCTTCCTT-20253/20254 (483 bp deletion + 19 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |