WormBase Tree Display for Variation: WBVar00251615

WBVar00251615 Name: Public_name: tm2781
    Other_name: ZK484.1b.1:c.66_*192-35del
      ZK484.1a.1:c.66_320-35del
    HGVSg: CHROMOSOME_I:g.6093411_6093796del
  Sequence_details: SMap: S_parent: Sequence: ZK484
    Flanking_sequences: atcgaatcaattggtcaacgagtctgccgt ccctgagaaatgtttgtaaacttttttatt
    Mapping_target: ZK484
    Source_location: 7 CHROMOSOME_I 6093410 6093797 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2781_external
      tm2781_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2781
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022748
    Transcript: ZK484.1b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK484.1b.1:c.66_*192-35del
        cDNA_position: 105-?
        CDS_position: 66-?
        Protein_position: 22-?
        Intron_number: 2-4/4
        Exon_number: 2-4/5
      ZK484.1a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK484.1a.1:c.66_320-35del
        cDNA_position: 66-?
        CDS_position: 66-?
        Protein_position: 22-?
        Intron_number: 1-3/4
        Exon_number: 1-3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: Gro. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000229 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: Sma. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. K.F. O'Connell: Ste. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 27359/27360-27745/27746 (386 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele