WormBase Tree Display for Variation: WBVar00251516

WBVar00251516 Name: Public_name: tm2669
    Other_name: AH6.1.1:c.549_1080+5del
    HGVSg: CHROMOSOME_II:g.9515235_9515917del
  Sequence_details: SMap: S_parent: Sequence: AH6
    Flanking_sequences: ttaagattttatgaatactttctataaacg tcactgaaataatacaacaatgcaactcga
    Mapping_target: AH6
    Source_location: 7 CHROMOSOME_II 9515234 9515918 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2669_external
      tm2669_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2669
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001528
    Transcript: AH6.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: AH6.1.1:c.549_1080+5del
        cDNA_position: 549-?
        CDS_position: 549-?
        Protein_position: 183-?
        Intron_number: 4-7/14
        Exon_number: 4-7/15
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0001058 Paper_evidence: WBPaper00033467
          WBPaper00042411
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson2987
        Remark: tm2669 animals can migrate up gradients of all salts as efficiently as wild-type animals can, except for ASER sensed K+, toward which gcy-1 mutant animals show a markedly decreased response Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
          Comment to the National Bioresource Project of Japan from Dr. O. Hobert: potassium chemotaxis defective. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OH
          Figure 2 Paper_evidence: WBPaper00042411
            Curator_confirmed: WBPerson2987
        Variation_effect: Null: Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00003917 Paper_evidence: WBPaper00042411
              Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0006935 PATO:0000460 Paper_evidence: WBPaper00042411
                Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000247 Paper_evidence: WBPaper00033467
        Curator_confirmed: WBPerson712
        Remark: tm2669 animals can migrate up gradients of all salts as efficiently as wild-type animals can, except for ASER sensed K+, toward which gcy-1 mutant animals show a markedly decreased response Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
      WBPhenotype:0000254 Paper_evidence: WBPaper00033467
        Curator_confirmed: WBPerson712
        Remark: tm2669 animals can migrate up gradients of all salts as efficiently as wild-type animals can, except for ASER sensed K+, toward which gcy-1 mutant animals show a markedly decreased response Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
      WBPhenotype:0001055 Paper_evidence: WBPaper00033467
        Curator_confirmed: WBPerson712
        Remark: tm2669 animals can migrate up gradients of all salts as efficiently as wild-type animals can, except for ASER sensed K+, toward which gcy-1 mutant animals show a markedly decreased response Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
      WBPhenotype:0001056 Paper_evidence: WBPaper00033467
        Curator_confirmed: WBPerson712
        Remark: tm2669 animals can migrate up gradients of all salts as efficiently as wild-type animals can, except for ASER sensed K+, toward which gcy-1 mutant animals show a markedly decreased response Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
      WBPhenotype:0001057 Paper_evidence: WBPaper00033467
        Curator_confirmed: WBPerson712
        Remark: tm2669 animals can migrate up gradients of all salts as efficiently as wild-type animals can, except for ASER sensed K+, toward which gcy-1 mutant animals show a markedly decreased response Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
      WBPhenotype:0001059 Paper_evidence: WBPaper00033467
        Curator_confirmed: WBPerson712
        Remark: tm2669 animals can migrate up gradients of all salts as efficiently as wild-type animals can, except for ASER sensed K+, toward which gcy-1 mutant animals show a markedly decreased response Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00033467
            Curator_confirmed: WBPerson712
      WBPhenotype:0001765 Paper_evidence: WBPaper00037908
        Curator_confirmed: WBPerson557
  Reference: WBPaper00033467
    WBPaper00042411
    WBPaper00037908
  Remark: 2666/2667-3349/3350 (683 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele