WormBase Tree Display for Variation: WBVar00251493
expand all nodes | collapse all nodes | view schema
WBVar00251493 | Name | Public_name | tm2644 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F56A3.2.1:c.816-153_867del | |||||||
HGVSg | CHROMOSOME_I:g.5185147_5185351del | |||||||
Sequence_details | SMap | S_parent | Sequence | F56A3 | ||||
Flanking_sequences | aactttcatcgaggcttcattgtatccaat | ctcacttttcgatggctgattacggtaatt | ||||||
Mapping_target | F56A3 | |||||||
Source_location | 7 | CHROMOSOME_I | 5185146 | 5185352 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2644_external | |||||||
tm2644_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034680 | |||||||
WBStrain00034681 | ||||||||
WBStrain00034683 | ||||||||
WBStrain00034698 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2644 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018909 | ||||||
Transcript | F56A3.2.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F56A3.2.1:c.816-153_867del | |||||||
cDNA_position | ?-867 | |||||||
CDS_position | ?-867 | |||||||
Protein_position | ?-289 | |||||||
Intron_number | 4/8 | |||||||
Exon_number | 5/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0001781 | Paper_evidence | WBPaper00041482 | ||||
Curator_confirmed | WBPerson113 | |||||||
Remark | shows hypersensitivity to UVC, nitrogen mustard, camptothecin | Paper_evidence | WBPaper00041482 | |||||
Curator_confirmed | WBPerson113 | |||||||
Affected_by | Molecule | WBMol:00005119 | Paper_evidence | WBPaper00041482 | ||||
Curator_confirmed | WBPerson113 | |||||||
WBMol:00001694 | Paper_evidence | WBPaper00041482 | ||||||
Curator_confirmed | WBPerson113 | |||||||
WBPhenotype:0002086 | Paper_evidence | WBPaper00041482 | ||||||
Curator_confirmed | WBPerson113 | |||||||
Remark | shows unbiassed distribution of crossover formation during meiosis. | Paper_evidence | WBPaper00041482 | |||||
Curator_confirmed | WBPerson113 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00041482 | |||||||
Remark | 14117/14118-14322/14323 (205 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |